NGS data logistics

Overview
Questions:
  • How to manipulate and process NGS data

Objectives:
  • Understand most common types of NGS-related datatypes

  • Learn about how Galaxy handles NGS data using Illumina data derived from patients infected with SARS-CoV-2

Time estimation: 1 hour 30 minutes
Supporting Materials:
Last modification: Oct 18, 2022
License: Tutorial Content is licensed under Creative Commons Attribution 4.0 International License The GTN Framework is licensed under MIT

In this section we will look at practical aspects of manipulation of next-generation sequencing data. We will start with the FASTQ format produced by most sequencing machines and will finish with the SAM/BAM format representing mapped reads. The cover image above shows a screen dump of a SAM dataset.

Introduction to sequencing data

FASTQ manipulation and quality control

FASTQ is not a very well defined format. In the beginning various manufacturers of sequencing instruments were free to interpret FASTQ as they saw fit, resulting in a multitude of FASTQ flavors. This variation stemmed primarily from different ways of encoding quality values as described here (below you will find an explanation of quality scores and their meaning). Today, the FASTQ Sanger version of the format is considered to be the standard form of FASTQ. Galaxy is using FASTQ Sanger as the only legitimate input for downstream processing tools and provides a number of utilities for converting FASTQ files into this form (see FASTQ Quality Control section of Galaxy tools).

The FASTQ format looks like this:


@M02286:19:000000000-AA549:1:1101:12677:1273 1:N:0:23
CCTACGGGTGGCAGCAGTGAGGAATATTGGTCAATGGACGGAAGTCTGAACCAGCCAAGTAGCGTGCAG
+
ABC8C,:@F:CE8,B-,C,-6-9-C,CE9-CC--C-<-C++,,+;CE<,,CD,CEFC,@E9<FCFCF?9
@M02286:19:000000000-AA549:1:1101:15048:1299 1:N:0:23
CCTACGGGTGGCTGCAGTGAGGAATATTGGACAATGGTCGGAAGACTGATCCAGCCATGCCGCGTGCAG
+
ABC@CC77CFCEG;F9<F89<9--C,CE,--C-6C-,CE:++7:,CF<,CEF,CFGGD8FFCFCFEGCF
@M02286:19:000000000-AA549:1:1101:11116:1322 1:N:0:23
CCTACGGGAGGCAGCAGTAGGGAATCTTCGGCAATGGACGGAAGTCTGACCGAGCAACGCCGCGTGAGT
+
AAC<CCF+@@>CC,C9,F9C9@9-CFFFE@7@:+CC8-C@:7,@EFE,6CF:+8F7EFEEF@EGGGEEE

Each sequencing read is represented by four lines:

  1. @ followed by read ID and optional information about sequencing run
  2. sequenced bases
  3. + (optionally followed by the read ID and some additional info)
  4. quality scores for each base of the sequence encoded as ASCII symbols

Paired end data

It is common to prepare pair-end and mate-pair sequencing libraries. This is highly beneficial for a number of applications discussed in subsequent topics. For now let’s just briefly discuss what these are and how they manifest themselves in FASTQ form.

 
Paired-end and mate-pair reads.
Paired-end and mate-pair reads. In paired end sequencing (left) the actual ends of rather short DNA molecules (less than 1kb) are determined, while for mate pair sequencing (right) the ends of long molecules are joined and prepared in special sequencing libraries. In these mate pair protocols, the ends of long, size-selected molecules are connected with an internal adapter sequence (i.e. linker, yellow) in a circularization reaction. The circular molecule is then processed using restriction enzymes or fragmentation. Fragments are enriched for the linker and outer library adapters are added around the two combined molecule ends. The internal adapter can then be used as a second priming site for an additional sequencing reaction in the same orientation or sequencing can be performed from the second adapter, from the reverse strand. (From “Understanding and improving high-throughput sequencing data production and analysis”, Ph.D. dissertation by Martin Kircher)

Thus in both cases (paired-end and mate-pair) a single physical piece of DNA (or RNA in the case of RNA-seq) is sequenced from two ends and so generates two reads. These can be represented as separate files (two FASTQ files with first and second reads) or a single file were reads for each end are interleaved. Here are examples:

Two single files

File 1

 @M02286:19:000000000-AA549:1:1101:12677:1273 1:N:0:23
 CCTACGGGTGGCAGCAGTGAGGAATATTGGTCAATGGACGGAAGTCT
 +
 ABC8C,:@F:CE8,B-,C,-6-9-C,CE9-CC--C-<-C++,,+;CE
 @M02286:19:000000000-AA549:1:1101:15048:1299 1:N:0:23
 CCTACGGGTGGCTGCAGTGAGGAATATTGGACAATGGTCGGAAGACT
 +
 ABC@CC77CFCEG;F9<F89<9--C,CE,--C-6C-,CE:++7:,CF

File 2

@M02286:19:000000000-AA549:1:1101:12677:1273 2:N:0:23
CACTACCCGTGTATCTAATCCTGTTTGATACCCGCACCTTCGAGCTTA
+
--8A,CCE+,,;,<CC,,<CE@,CFD,,C,CFF+@+@CCEF,,,B+C,
@M02286:19:000000000-AA549:1:1101:15048:1299 2:N:0:23
CACTACCGGGGTATCTAATCCTGTTCGCTCCCCACGCTTTCGTCCATC
+
-6AC,EE@::CF7CFF<<FFGGDFFF,@FGGGG?F7FEGGGDEFF>FF
Comment: Read order is important

Note that read IDs are identical in two files and they are listed in the same order. In some cases read IDs in the first and second file may be appended with /1 and /2 tags, respectively.

Interleaved file

@1/1
AGGGATGTGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA
+
EGGEGGGDFGEEEAEECGDEGGFEEGEFGBEEDDECFEFDD@CDD<ED
@1/2
CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC
+
GHHHDFDFGFGEGFBGEGGEGEGGGHGFGHFHFHHHHHHHEF?EFEFF
@2/1
AGGGATGTGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA
+
HHHHHHEGFHEEFEEHEEHHGGEGGGGEFGFGGGGHHHHFBEEEEEFG
@2/2
CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC
+
HHHHHHHHHHHHHGHHHHHHGHHHHHHHHHHHFHHHFHHHHHHHHHHH

Here the first and the second reads are identified with /1 and /2 tags.

Comment: FASTQ format is a loose standard

FASTQ format is not strictly defined and its variations will always cause headache for you. See this page for more information.

What are base qualities?

As we’ve seen above, FASTQ datasets contain two types of information:

  • sequence of the read
  • base qualities for each nucleotide in the read.

The base qualities allow us to judge how trustworthy each base in a sequencing read is. The following excerpt from an excellent tutorial by Friederike Dündar, Luce Skrabanek, Paul Zumbo explains what base qualities are:

Comment: From "Introduction to differential gene expression analysis using RNA-seq"

Illumina sequencing is based on identifying the individual nucleotides by the fluorescence signal emitted upon their incorporation into the growing sequencing read. Once the fluorescence intensities are extracted and translated into the four letter code. The deduction of nucleotide sequences from the images acquired during sequencing is commonly referred to as base calling.
Due to the imperfect nature of the sequencing process and limitations of the optical instruments, base calling will always have inherent uncertainty. This is the reason why FASTQ files store the DNA sequence of each read together with a position-specific quality score that represents the error probability, i.e., how likely it is that an individual base call may be incorrect. The score is called Phred score, \(Q\), which is proportional to the probability \(p\) that a base call is incorrect, where \(Q = −10lg(p)\). For example, a Phred score of 10 corresponds to one error in every ten base calls (\(Q = −10lg(0.1)\)), or 90% accuracy; a Phred score of 20 corresponds to one error in every 100 base calls, or 99% accuracy. A higher Phred score thus reflects higher confidence in the reported base.
To assign each base a unique score identifier (instead of numbers of varying character length), Phred scores are typically represented as ASCII characters. At http://ascii-code.com/ you can see which characters are assigned to what number.
For raw reads, the range of scores will depend on the sequencing technology and the base caller used (Illumina, for example, used a tool called Bustard, or, more recently, RTA). Unfortunately, Illumina has been anything but consistent in how they calculated and ASCII-encoded the Phred score (see below)! In addition, Illumina now allows Phred scores for base calls with as high as 45, while 41 used to be the maximum score until the HiSeq X. This may cause issues with downstream sapplications that expect an upper limit of 41.

Illumina quality score.

Base call quality scores are represented with the Phred range. Different Illumina (formerly Solexa) versions used different scores and ASCII offsets. Starting with Illumina format 1.8, the score now represents the standard Sanger/Phred format that is also used by other sequencing platforms and the sequencing archives.

 
FASTQ quality score.
The ASCII interpretation and ranges of the different Phred score notations used by Illumina and the original Sanger interpretation. Although the Sanger format allows a theoretical score of 93, raw sequencing reads typically do not exceed a Phred score of 60. In fact, most Illumina-based sequencing will result in maximum scores of 41 to 45 (image from Wikipedia)

Assessing data quality

One of the first steps in the analysis of NGS data is seeing how good the data actually is. FastqQC is a fantastic tool allowing you to assess the quality of FASTQ datasets (and deciding whether to blame or not to blame whoever has done sequencing for you).

   
Good quality in FastQC. Bad quality in FastQC.
A. Excellent quality B. Hmmm…OK

Here you can see FastQC base quality reports (the tools gives you many other types of data) for two datasets: A and B. The A dataset has long reads (250 bp) and very good quality profile with no qualities dropping below phred score of 30. The B dataset is significantly worse with ends of the reads dipping below phred score of 20. The B reads may need to be trimmed for further processing.

Mapping your data

Mapping of NGS reads against reference sequences is one of the key steps of the analysis. Now it is time to see how this is done in practice. Below is a list of key publications highlighting mainstream mapping tools:

Mapping against a pre-computed genome index

Mappers usually compare reads against a reference sequence that has been transformed into a highly accessible data structure called genome index. Such indexes should be generated before mapping begins. Galaxy instances typically store indexes for a number of publicly available genome builds.

 
Cached genome.
Mapping against a pre-computed index in Galaxy.

For example, the image above shows indexes for hg38 version of the human genome. You can see that there are actually three choices: (1) hg38, (2) hg38 canonical and (3) hg38 canonical female. The hg38 contains all chromosomes as well as all unplaced contigs. The hg38 canonical does not contain unplaced sequences and only consists of chromosomes 1 through 22, X, Y, and mitochondria. The hg38 canonical female contains everything from the canonical set with the exception of chromosome Y.

What if pre-computed index does not exist?

If Galaxy does not have a genome you need to map against, you can upload your genome sequence as a FASTA file and use it in the mapper directly as shown below (Load reference genome is set to History).

 
Uploaded genome.
Mapping against a pre-computed index in Galaxy

In this case Galaxy will first create an index from this dataset and then run mapping analysis against it.

SAM/BAM datasets

The SAM/BAM format is an accepted standard for storing aligned reads (it can also store unaligned reads and some mappers such as BWA are accepting unaligned BAM as input). The binary form of the format (BAM) is compact and can be rapidly searched (if indexed). In Galaxy BAM datasets are always indexed (accompanies by a .bai file) and sorted in coordinate order. In the following duscussion I once again rely on tutorial by Friederike Dündar, Luce Skrabanek, and Paul Zumbo.

The Sequence Alignment/Map (SAM) format is, in fact, a generic nucleotide alignment format that describes the alignment of sequencing reads (or query sequences) to a reference. The human readable, TABdelimited SAM files can be compressed into the Binary Alignment/Map format. These BAM files are bigger than simply gzipped SAM files, because they have been optimized for fast random access rather than size reduction. Position-sorted BAM files can be indexed so that all reads aligning to a locus can be efficiently retrieved without loading the entire file into memory.

As shown below, SAM files typically contain a short header section and a very long alignment section where each row represents a single read alignment. The following sections will explain the SAM format in a bit more detail. For the most comprehensive and updated information go to https://github.com/samtools/hts-specs.

 
BAM structure.
Schematic representation of a SAM file. Each line of the optional header section starts with “@”, followed by the appropriate abbreviation (e.g., SQ for sequence dictionary which lists all chromosomes names (SN) and their lengths (LN)). The vast majority of lines within a SAM file typically correspond to read alignments where each read is described by the 11 mandatory entries (black font) and a variable number of optional fields (grey font). From tutorial by Friederike Dündar, Luce Skrabanek, and Paul Zumbo.

SAM Header

The header section includes information about how the alignment was generated and stored. All lines in the header section are tab-delimited and begin with the “@” character, followed by tag:value pairs, where tag is a two-letter string that defines the content and the format of value. For example, the “@SQ” line in the header section contains the information about the names and lengths of the *reference sequences to which the reads were aligned. For a hypothetical organism with three chromosomes of length 1,000 bp, the SAM header should contain the following three lines:

@SQ SN:chr1 LN:1000
@SQ SN:chr2 LN:1000
@SQ SN:chr3 LN:1000

SAM alignment section

The optional header section is followed by the alignment section where each line corresponds to one sequenced read. For each read, there are 11 mandatory fields that always appear in the same order:

<QNAME> <FLAG> <RNAME> <POS> <MAPQ> <CIGAR> <MRNM> <MPOS> <ISIZE> <SEQ> <QUAL>

If the corresponding information is unavailable or irrelevant, field values can be ‘0’ or ‘*’ (depending on the field, see below), but they cannot be missing! After the 11 mandatory fields, a variable number of optional fields can be present. Here’s an example of one single line of a real-life SAM file (you may need to scroll sideways):

ERR458493 .552967 16 chrI 140 255 12 M61232N37M2S * 0 0 CCACTCGTTCACCAGGGCCGGCGGGCTGATCACTTTATCGTGCATCTTGGC BB?HHJJIGHHJIGIIJJIJGIJIJJIIIGHBJJJJJJHHHHFFDDDA1+B NH:i:1 HI:i:1 AS:i:41 nM:i:2

The following table explains the format and content of each field. The FLAG, CIGAR, and the optional fields (marked in blue) are explained in more detail below. The number of optional fields can vary widely between different SAM files and even between reads within in the same file. The field types marked in blue are explained in more detail in the main text below.

SAM fields.

FLAG field

The FLAG field encodes various pieces of information about the individual read, which is particularly important for PE reads. It contains an integer that is generated from a sequence of bits (0, 1). This way, answers to multiple binary (Yes/No) questions can be compactly stored as a series of bits, where each of the single bits can be addressed and assigned separately.

The following table gives an overview of the different properties that can be encoded in the FLAG field. The developers of the SAM format and samtools tend to use the hexadecimal encoding as a means to refer to the different bits in their documentation. The value of the FLAG field in a given SAM file, however, will always be the decimal representation of the sum of the underlying binary values (as shown in Table below, row 2).

 
SAM flag.
The FLAG field of SAM files stores information about the respective read alignment in one single decimal number. The decimal number is the sum of all the answers to the Yes/No questions associated with each binary bit. The hexadecimal representation is used to refer to the individual bits (questions). A bit is set if the corresponding state is true. For example, if a read is paired, 0x1 will be set, returning the decimal value of 1. Therefore, all FLAG values associated with paired reads must be uneven decimal numbers. Conversely, if the 0x1 bit is unset (= read is not paired), no assumptions can be made about 0x2, 0x8, 0x20, 0x40 and 0x80 because they refer to paired reads. From tutorial by Friederike Dündar, Luce Skrabanek, and Paul Zumbo

In a run with single reads, the flags you most commonly see are:

  • 0: This read has been mapped to the forward strand. (None of the bit-wise flags have been set.)
  • 4: The read is unmapped (0x4 is set).
  • 16: The read is mapped to the reverse strand (0x10 is set)

(0x100, 0x200 and 0x400 are not used by most aligners/mappers, but could, in principle be set for single reads.) Some common FLAG values that you may see in a PE experiment include:

   
69 (= 1 + 4 + 64) The read is paired, is the first read in the pair, and is unmapped.
77 (= 1 + 4 + 8 + 64) The read is paired, is the first read in the pair, both are unmapped.
83 (= 1 + 2 + 16 + 64) The read is paired, mapped in a proper pair, is the first read in the pair, and it is mapped to the reverse strand.
99 (= 1 + 2 + 32 + 64) The read is paired, mapped in a proper pair, is the first read in the pair, and its mate is mapped to the reverse strand.
133 (= 1 + 4 + 128) The read is paired, is the second read in the pair, and it is unmapped.
137 (= 1 + 8 + 128) The read is paired, is the second read in the pair, and it is mapped while its mate is not.
141 (= 1 + 4 + 8 + 128) The read is paired, is the second read in the pair, but both are unmapped.
147 (= 1 + 2 + 16 + 128) The read is paired, mapped in a proper pair, is the second read in the pair, and mapped to the reverse strand.
163 (= 1 + 2 + 32 + 128) The read is paired, mapped in a proper pair, is the second read in the pair, and its mate is mapped to the reverse strand.

A useful website for quickly translating the FLAG integers into plain English explanations like the ones shown above is: https://broadinstitute.github.io/picard/explain-flags.html

CIGAR string

CIGAR stands for Concise Idiosyncratic Gapped Alignment Report. This sixth field of a SAM file contains a so-called CIGAR string indicating which operations were necessary to map the read to the reference sequence at that particular locus.

The following operations are defined in CIGAR format (also see figure below):

  • M - Alignment (can be a sequence match or mismatch!)
  • I - Insertion in the read compared to the reference
  • D - Deletion in the read compared to the reference
  • N - Skipped region from the reference. For mRNA-to-genome alignments, an N operation represents an intron. For other types of alignments, the interpretation of N is not defined.
  • S - Soft clipping (clipped sequences are present in read); S may only have H operations between them and the ends of the string
  • H - Hard clipping (clipped sequences are NOT present in the alignment record); can only be present as the first and/or last operation
  • P - Padding (silent deletion from padded reference)
  • = - Sequence match (not widely used)
  • X - Sequence mismatch (not widely used)

The sum of lengths of the M, I, S, =, X operations must equal the length of the read. Here are some examples:

 
CIGAR.
From tutorial by Friederike Dündar, Luce Skrabanek, and Paul Zumbo.

Optional fields

Following the eleven mandatory SAM file fields, the optional fields are presented as key-value pairs in the format of <TAG>:<TYPE>:<VALUE>, where TYPE is one of:

  • A - Character
  • i - Integer
  • f - Float number
  • Z - String
  • H - Hex string

The information stored in these optional fields will vary widely depending on the mapper and new tags can be added freely. In addition, reads within the same SAM file may have different numbers of optional fields, depending on the program that generated the SAM file. Commonly used optional tags include:

  • AS:i - Alignment score
  • BC:Z - Barcode sequence
  • HI:i - Match is i-th hit to the read
  • NH:i - Number of reported alignments for the query sequence
  • NM:i - Edit distance of the query to the reference
  • MD:Z - String that contains the exact positions of mismatches (should complement the CIGAR string)
  • RG:Z - Read group (should match the entry after ID if @RG is present in the header.

Thus, for example, we can use the NM:i:0 tag to select only those reads which map perfectly to the reference(i.e., have no mismatches). While the optional fields listed above are fairly standardized, tags that begin with X, Y, and Z are reserved for particularly free usage and will never be part of the official SAM file format specifications. XS, for example, is used by TopHat (an RNA-seq analysis tool we will discuss later) to encode the strand information (e.g., XS:A:+) while Bowtie2 and BWA use XS:i: for reads with multiple alignments to store the alignment score for the next-best-scoring alignment (e.g., XS:i:30).

Read Groups

One of the key features of SAM/BAM format is the ability to label individual reads with readgroup tags. This allows pooling results of multiple experiments into a single BAM dataset. This significantly simplifies downstream logistics: instead of dealing with multiple datasets one can handle just one. Many downstream analysis tools such as variant callers are designed to recognize readgroup data and output results on per-readgroup basis.

One of the best descriptions of BAM readgroups is on GATK support site. We have gratefully stolen two tables describing the most important readgroup tags - ID, SM, LB, and PL - from GATK forum and provide them here:

Read groups.

GATK forum also provides the following example:

Read group example.

Manipulating SAM/BAM datasets

We support four major toolsets for processing of SAM/BAM datasets:

  • DeepTools - a suite of user-friendly tools for the visualization, quality control and normalization of data from deep-sequencing DNA sequencing experiments.
  • SAMtools - various utilities for manipulating alignments in the SAM/BAM format, including sorting, merging, indexing and generating alignments in a per-position format.
  • BEDtools - a toolkit originally written for BED format was expanded for analysis of BAM and VCF datasets.
  • Picard - a set of Java tools for manipulating high-throughput sequencing data (HTS) data and formats.

The challenge of read duplicates

PCR duplicates

Preparation of sequencing libraries (at least at the time of writing) for technologies such as Illumina (used in this example) involves PCR amplification. It is required to generate sufficient number of sequencing templates so that a reliable detection can be performed by base callers. Yet PCR has its biases, which are especially profound in cases of multitemplate PCR used for construction of sequencing libraries (Kanagawa et al. 2003).

 
PCR duplicates.
Analyzing molecules aligning with the same outer coordinates, a mapping quality of at least 30 and a length of at least 30nt, resulted in an average coverage of 12.9 per PCR duplicate and an empirical coverage distribution similar to an exponential/power law distribution (left upper panel). This indicates that many molecules are only observed for deeper sequencing while other molecules are available at higher frequencies. Analyzing length (left middle panel) and GC content (left lower panel) patterns as well as the combination (right panel) shows higher PCR duplicate counts for a GC content between 30% to 70% as well as for shorter molecules compared to longer molecules. This effect may be due to an amplification bias from the polymerase or the cluster generation process necessary for Illumina sequencing. From Ph.D. dissertation of Martin Kircher).

Duplicates can be identified based on their outer alignment coordinates or using sequence-based clustering. One of the common ways for identification of duplicate reads is the MarkDuplicates utility from Picard package. It is designed to identify both PCR and optical duplicates:

Duplicates are identified as read pairs having identical 5' positions (coordinate and strand) for both reads in a mate pair (and optionally, matching unique molecular identifier reads; see BARCODE_TAG option). Optical, or more broadly Sequencing, duplicates are duplicates that appear clustered together spatially during sequencing and can arise from optical/imagine-processing artifacts or from bio-chemical processes during clonal amplification and sequencing; they are identified using the READ_NAME_REGEX and the OPTICAL_DUPLICATE_PIXEL_DISTANCE options. The tool's main output is a new SAM or BAM file in which duplicates have been identified in the SAM flags field, or optionally removed (see REMOVE_DUPLICATE and REMOVE_SEQUENCING_DUPLICATES), and optionally marked with a duplicate type in the 'DT' optional attribute. In addition, it also outputs a metrics file containing the numbers of READ_PAIRS_EXAMINED, UNMAPPED_READS, UNPAIRED_READS, UNPAIRED_READ DUPLICATES, READ_PAIR_DUPLICATES, and READ_PAIR_OPTICAL_DUPLICATES. Usage example: java -jar picard.jar MarkDuplicates I=input.bam \ O=marked_duplicates.bam M=marked_dup_metrics.txt.`

Sampling coincidence duplicates

However, one has to be careful when removing duplicates in cases when the sequencing targets are small (e.g., sequencing of bacterial, viral, or organellar genomes as well as amplicons). This is because when sequencing target is small reads will have the same coordinates by chance and not because of PCR amplification issues. The figure below illustrates the fine balance between estimates allele frequency, coverage, and variation in insert size:

 
Sampling bias.
The Variant Allele Frequency (VAF) bias determined by coverage and insert size variance. Reads are paired-end and read length is 76. The insert size distribution is modeled as a Gaussian distribution with mean at 200 and standard deviation shown on the x-axis. The true VAF is 0.05. The darkness at each position indicates the magnitude of the bias in the VAF. (From Zhou et al. 2013).

Getting NGS data to Galaxy

You can upload data in Galaxy using one of these ways:

From your computer

This works well for small files because web browser do not like lengthy file transfers:

Using FTP

FTP (file transfer protocol) allows transferring large collection of files:

From NCBI short read archive

Finally, datasets can be uploaded directly from NCBI’s short read archive:

Comment

We will use this last approach, getting data from NCBI SRA, in this tutorial.

Let’s do it: From reads to variants

In primary analysis we start with raw sequencing data (e.g., fastq reads) and convert them into a dataset for secondary analysis. Such dataset can be a list of sequence variants, a collection of ChIP-seq peaks, a list of differentially expressed genes and so on.

SARS-CoV-2 is undoubtedly the most talked about biological system of the day. We will use SARS-CoV-2 sequencing data to demonstrate how Galaxy handles NGS data. In this case we will go from FASTQ data to a list of variants.

Find necessary data in SRA

First we need to find a good dataset to play with. The Sequence Read Archive (SRA) is the primary archive of unassembled reads operated by the US National Institutes of Health (NIH). SRA is a great place to get the sequencing data that underlie publications and studies. Let’s do that:

Hands-on: Get Metadata from NCBI SRA
  1. Go to NCBI’s SRA page by pointing your browser to https://www.ncbi.nlm.nih.gov/sra
  2. In the search box enter SARS-CoV-2 Patient Sequencing From Partners / MGH: Find data. (Alternatively, you simply click on this link)
  3. The web page will show a large number of SRA datasets (at the time of writing there were 2,223). This is data from a study describing analysis of SARS-CoV-2 in Boston area.
  4. Download metadata describing these datasets by:
    • clicking on Send to: dropdown
    • Selecting File
    • Changing Format to RunInfo
    • Clicking Create file Here is how it should look like: Getting RunInfo from SRA.
  5. This would create a rather large SraRunInfo.csv file in your Downloads folder.

Now that we have downloaded this file we can go to a Galaxy instance and start processing it.

Comment

Note that the file we just downloaded is not sequencing data itself. Rather, it is metadata describing properties of sequencing reads. We will filter this list down to just a few accessions that will be used in the remainder of this tutorial.

Process and filter SraRunInfo.csv file in Galaxy

Hands-on: Upload `SraRunInfo.csv` file into Galaxy
  1. Go to your Galaxy instance of choice such as one of the usegalaxy.org, usegalaxy.eu, usegalaxy.org.au or any other. (This tutorial uses usegalaxy.org).
  2. Click Upload Data button: Data upload button.
  3. In the dialog box that would appear click “Choose local files” button: Choose local files button.
  4. Find and select SraRunInfo.csv file from your computer
  5. Click Start button
  6. Close dialog by pressing Close button
  7. You can now look at the content of this file by clicking galaxy-eye (eye) icon. You will see that this file contains a lot of information about individual SRA accessions. In this study every accession corresponds to an individual patient whose samples were sequenced.

Galaxy can process all 2,000+ datasets, but to make this tutorial bearable we need to selected a smaller subset. In particular our previous experience with this data shows two interesting datasets SRR11954102 and SRR12733957. So, let’s pull them out.

Warning: Beware of Cuts

The section below uses Cut tool. There are two cut tools in Galaxy due to historical reasons. This example uses tool with the full name Cut columns from a table (cut). However, the same logic applies to the other tool. It simply has a slightly different interface.

Hands-on: Creating a subset of data
  1. Find Select lines that match an expression Tool: Grep1 tool in Filter and Sort section of the tool panel.

    Galaxy may have an overwhelming amount of tools installed. To find a specific tool type the tool name in the tool panel search box to find the tool.

  2. Make sure the SraRunInfo.csv dataset we just uploaded is listed in the param-file “Select lines from” field of the tool form.
  3. In “the pattern” field enter the following expression → SRR12733957|SRR11954102. These are two accession we want to find separated by the pipe symbol |. The | means or: find lines containing SRR12733957 or SRR11954102.
  4. Click Execute button.
  5. This will generate a file containing two lines (well … one line is also used as the header, so it will appear the the file has three lines. It is OK.)
  6. Cut the first column from the file using Cut Tool: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cut_tool/1.1.0 tool, which you will find in Text Manipulation section of the tool pane.
  7. Make sure the dataset produced by the previous step is selected in the “File to cut” field of the tool form.
  8. Change “Delimited by” to Comma
  9. In “List of fields” select Column: 1.
  10. Hit Execute This will produce a text file with just two lines:
    SRR12733957
    SRR11954102
    

Now that we have identifiers of datasets we want we need to download the actual sequencing data. You can also watch this video.

Download sequencing data

Hands-on: Get data from SRA
  1. Run Faster Download and Extract Reads in FASTQ Tool: toolshed.g2.bx.psu.edu/repos/iuc/sra_tools/fasterq_dump/2.10.9+galaxy0 with the following parameters:
    • “select input type”: List of SRA accession, one per line
      • The parameter param-file “sra accession list” should point the output of the tool “Cut” from the previous step.
    • Click the Execute button. This will run the tool, which retrieves the sequence read datasets for the runs that were listed in the SRA dataset. It may take some time. So this may be a good time to take a break.
  2. Several entries are created in your history panel when you submit this job:
    • Pair-end data (fasterq-dump): Contains Paired-end datasets (if available)
    • Single-end data (fasterq-dump) Contains Single-end datasets (if available)
    • Other data (fasterq-dump) Contains Unpaired datasets (if available)
    • fasterq-dump log Contains Information about the tool execution

The first three items are actually collections of datasets. Collections in Galaxy are logical groupings of datasets that reflect the semantic relationships between them in the experiment / analysis. In this case the tool creates separate collections for paired-end reads, single reads, and other. See the Collections tutorial and watch videos (with names beginning with “Dataset Collections”) for more information.

Explore the collections by first clicking on the collection name in the history panel. This takes you inside the collection and shows you the datasets in it. You can then navigate back to the outer level of your history.

Once fasterq finishes transferring data (all boxes are green / done), we are ready to analyze it.

Now what?

You can now analyze the retrieved data using any sequence analysis tools and workflows in Galaxy. SRA holds backing data for every imaginable type of *-seq experiment.

If you ran this tutorial, but retrieved datasets that you were interested in, then see the rest of the GTN library for ideas on how to analyze in Galaxy.

However, if you retrieved the datasets used in this tutorial’s examples above, then you are ready to run the SARS-CoV-2 variant analysis below.

In this part of the tutorial we will perform variant calling and basic analysis of the datasets downloaded above. We will start by downloading the Wuhan-Hu-1 SARS-CoV-2 reference sequence, then run adapter trimming, alignment and variant calling.

Comment: The usegalaxy.* COVID-19 analysis project

This tutorial uses a subset of the data and runs through the Variation Analysis section of covid19.galaxyproject.org. The data for covid19.galaxyproject.org is being updated continuously as new datasets are made public.

Get the reference genome data

The reference genome data for today is for SARS-CoV-2, “Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome”, having the accession ID of NC_045512.2.

This data is available from directly from GenBank using the following link.

Hands-on: Get the reference genome data
  1. Import the following file into your history:

    https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/009/858/895/GCF_009858895.2_ASM985889v3/GCF_009858895.2_ASM985889v3_genomic.fna.gz
    
    • Copy the link location
    • Open the Galaxy Upload Manager (galaxy-upload on the top-right of the tool panel)

    • Select Paste/Fetch Data
    • Paste the link into the text field

    • Press Start

    • Close the window

Adapter trimming with fastp

Removing sequencing adapters improves alignments and variant calling. fastp tool can automatically detect widely used sequencing adapters.

Hands-on: Running `fastp`

Run fastp Tool: toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.20.1+galaxy0 with the following parameters:

  • “Single-end or paired reads”: Paired Collection
    • param-file “Select paired collection(s)”: list_paired (output of Faster Download and Extract Reads in FASTQ tool)
  • In “Output Options”:
    • “Output JSON report”: Yes

Alignment with Map with BWA-MEM

BWA-MEM tool is a widely used sequence aligner for short-read sequencing datasets such as those we are analysing in this tutorial.

Hands-on: Map sequencing reads to reference genome

Run BWA-MEM Tool: toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.17.1 with the following parameters:

  • “Will you select a reference genome from your history or use a built-in index?”: Use a genome from history and build index
    • param-file “Use the following dataset as the reference sequence”: output (Input dataset)
  • “Single or Paired-end reads”: Paired Collection
    • param-file “Select a paired collection”: output_paired_coll (output of fastp tool)
  • “Set read groups information?”: Do not set
  • “Select analysis mode”: 1.Simple Illumina mode

Remove duplicates with MarkDuplicates

MarkDuplicates tool removes duplicate sequences originating from library preparation artifacts and sequencing artifacts. It is important to remove these artefactual sequences to avoid artificial overrepresentation of single molecule.

Hands-on: Remove duplicates

Run MarkDuplicates Tool: toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.2 with the following parameters:

  • param-file “Select SAM/BAM dataset or dataset collection”: bam_output (output of Map with BWA-MEM tool)
  • “If true do not write duplicates to the output file instead of writing them with appropriate flags set”: Yes

Realign reads with lofreq viterbi

Realign reads tool corrects misalignments around insertions and deletions. This is required in order to accurately detect variants.

Hands-on: Realign reads around indels

Run Realign reads Tool: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_viterbi/lofreq_viterbi/2.1.5+galaxy0 with the following parameters:

  • param-file “Reads to realign”: outFile (output of MarkDuplicates tool)
  • “Choose the source for the reference genome”: History
    • param-file “Reference”: output (Input dataset)
  • In “Advanced options”:
    • “How to handle base qualities of 2?”: Keep unchanged

Add indel qualities with lofreq Insert indel qualities

This step adds indel qualities into our alignment file. This is necessary in order to call variants using Call variants with lofreq tool

Hands-on: Add indel qualities

Run Insert indel qualities Tool: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_indelqual/lofreq_indelqual/2.1.5+galaxy0 with the following parameters:

  • param-file “Reads”: realigned (output of Realign reads tool)
  • “Indel calculation approach”: Dindel
    • “Choose the source for the reference genome”: History
      • param-file “Reference”: output (Input dataset)

Call Variants using lofreq Call variants

We are now ready to call variants.

Hands-on: Call variants

Run Call variants Tool: toolshed.g2.bx.psu.edu/repos/iuc/lofreq_call/lofreq_call/2.1.5+galaxy1 with the following parameters:

  • param-file “Input reads in BAM format”: output (output of Insert indel qualities tool)
  • “Choose the source for the reference genome”: History
    • param-file “Reference”: output (Input dataset)
  • “Call variants across”: Whole reference
  • “Types of variants to call”: SNVs and indels
  • “Variant calling parameters”: Configure settings
    • In “Coverage”:
      • “Minimal coverage”: 50
    • In “Base-calling quality”:
      • “Minimum baseQ”: 30
      • “Minimum baseQ for alternate bases”: 30
    • In “Mapping quality”:
      • “Minimum mapping quality”: 20
  • “Variant filter parameters”: Preset filtering on QUAL score + coverage + strand bias (lofreq call default)

The output of this step is a collection of VCF files that can be visualized in a genome browser.

Annotate variant effects with SnpEff eff:

We will now annotate the variants we called in the previous step with the effect they have on the SARS-CoV-2 genome.

Hands-on: Annotate variant effects

Run SnpEff Tool: toolshed.g2.bx.psu.edu/repos/iuc/snpeff_sars_cov_2/snpeff_sars_cov_2/4.5covid19 with the following parameters:

  • param-file “Sequence changes (SNPs, MNPs, InDels)”: variants (output of Call variants tool)
  • “Output format”: VCF (only if input is VCF)
  • “Create CSV report, useful for downstream analysis (-csvStats)”: Yes
  • “Annotation options”: ``
  • “Filter output”: ``
  • “Filter out specific Effects”: No

The output of this step is a VCF file with added variant effects.

Create table of variants using SnpSift Extract Fields

We will now select various effects from the VCF and create a tabular file that is easier to understand for humans.

Hands-on: Create table of variants

Run SnpSift Extract Fields Tool: toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_extractFields/4.3+t.galaxy0 with the following parameters:

  • param-file “Variant input file in VCF format”: snpeff_output (output of SnpEff eff: tool)
  • “Fields to extract”: CHROM POS REF ALT QUAL DP AF SB DP4 EFF[*].IMPACT EFF[*].FUNCLASS EFF[*].EFFECT EFF[*].GENE EFF[*].CODON
  • “One effect per line”: Yes
  • “empty field text”: .

We can inspect the output files and see check if Variants in this file are also described in an observable notebook that shows the geographic distribution of SARS-CoV-2 variant sequences

Interesting variants include the C to T variant at position 14408 (14408C/T) in SRR11772204, 28144T/C in SRR11597145 and 25563G/T in SRR11667145.

Summarize data with MultiQC

We will now summarize our analysis with MultiQC, which generates a beautiful report for our data.

Hands-on: Summarize data

Run MultiQC Tool: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.8+galaxy1 with the following parameters:

  • In “Results”:
    • param-repeat “Insert Results”
      • “Which tool was used generate logs?”: fastp
        • param-file “Output of fastp”: report_json (output of fastp tool)
    • param-repeat “Insert Results”
      • “Which tool was used generate logs?”: Picard
        • In “Picard output”:
          • param-repeat “Insert Picard output”
            • “Type of Picard output?”: Markdups
            • param-file “Picard output”: metrics_file (output of MarkDuplicates tool)

The above state allows us to judge the quality of the data. In this particular case data is not bad as quality values never drop below 30:

MultiQC plot.

Collapse data into a single dataset

We now extracted meaningful fields from VCF datasets. But they still exist as a collection. To move towards secondary analysis we need to collapse this collection into a single dataset. For more information about collapsing collections see this video:

Hands-on: Collapse a collection

Run Collapse Collection Tool: toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/4.0 with the following parameters:

  • param-collection “Collection of files to collapse into single dataset”: snpsift extract fields (output of SnpSift Extract Fields tool)
  • “Keep one header line”: Yes
  • “Prepend File name”: Yes
  • “Where to add dataset name”: Same line and each line in dataset

You can see that this tool takes lines from all collection elements (in our case we have two), add element name as the first column, and pastes everything together. So if we have a collection as an input:

Input: A collection with two items

A collection element named SRR11954102

NC_045512.2  84 PASS  C T  960.0  28  1.0       0 0,0,15,13 MODIFIER  NONE  INTERGENIC
NC_045512.2 241 PASS  C T 2394.0  69  0.971014  0 0,0,39,29 MODIFIER  NONE  INTERGENIC

A collection element named SRR12733957:

NC_045512.2 241 PASS  C T 1954.0  63  0.888889  0 0,0,42,21 MODIFIER  NONE  INTERGENIC
NC_045512.2 823 PASS  C T 1199.0  50  0.76      3 5,6,13,26 LOW       LOW   LOW

We will have a single dataset as the output:

Output: A single dataset

then the Collapse Collection tool will produce this:

SRR11954102 NC_045512.2  84 PASS  C T  960.0  28  1.0       0 0,0,15,13 MODIFIER  NONE  INTERGENIC
SRR11954102 NC_045512.2 241 PASS  C T 2394.0  69  0.971014  0 0,0,39,29 MODIFIER  NONE  INTERGENIC
SRR12733957 NC_045512.2 241 PASS  C T 1954.0  63  0.888889  0 0,0,42,21 MODIFIER  NONE  INTERGENIC
SRR12733957 NC_045512.2 823 PASS  C T 1199.0  50  0.76      3 5,6,13,26 LOW       LOW   LOW

you can see that added a column with dataset ID taken from collection element name.

Anything interesting?

These data are now ready for downstream analysis. One of the interesting things about these data is that it contains some of the mutations identified in the B.1.1.7 lineage. For example, dataset SRR12733957 contains a nonsense mutation (change for legitimate codon specifying an amino acid to a stop codon) in ORF8a:

SRR12733957 NC_045512.2 27972 PASS  C T 56.0  39  0.076923  0 7,29,0,3  HIGH  NONSENSE  STOP_GAINED ORF8  Caa/Taa

This is interesting because these datasets were collected well before B.1.1.7 became widely spread. Can you find more mutations here in these data?

Conclusion

Congratulations, you now know how to import sequence data from the SRA and how to run an example analysis on these datasets.

Key points
  • FASTQ Sanger version of the format is considered to be the standard form of FASTQ.

  • Paired end data can be provided as two files or as an interleaved one.

  • FastqQC is a tool allowing to check the quality of FASTQ datasets.

  • The most common tools for mapping are Bowtie, BWA, BWA-MEM. You can use in-built genome to map against or upload one if it is missing.

  • The standard format for storing aligned reads is SAM/BAM. The major toolsets to process these datasets are DeepTools, SAMtools, BAMtools and Picard.

  • Data can be uploaded directly from a computer, from EBI SRA and from NCBI SRA, also using FTP or URL.

  • One can retrieve NGS data from Sequence Read Archive

  • Galaxy can analyze massive amounts of data and make them suitable for secondary analysis

Frequently Asked Questions

Have questions about this tutorial? Check out the tutorial FAQ page or the FAQ page for the Introduction to Galaxy Analyses topic to see if your question is listed there. If not, please ask your question on the GTN Gitter Channel or the Galaxy Help Forum

Feedback

Did you use this material as an instructor? Feel free to give us feedback on how it went.
Did you use this material as a learner or student? Click the form below to leave feedback.

Click here to load Google feedback frame

Citing this Tutorial

  1. Anton Nekrutenko, Marius van den Beek, Dave Clements, Daniel Blankenberg, NGS data logistics (Galaxy Training Materials). https://training.galaxyproject.org/training-material/topics/introduction/tutorials/galaxy-intro-ngs-data-managment/tutorial.html Online; accessed TODAY
  2. Batut et al., 2018 Community-Driven Data Analysis Training for Biology Cell Systems 10.1016/j.cels.2018.05.012



@misc{introduction-galaxy-intro-ngs-data-managment,
author = "Anton Nekrutenko and Marius van den Beek and Dave Clements and Daniel Blankenberg",
title = "NGS data logistics (Galaxy Training Materials)",
year = "",
month = "",
day = ""
url = "\url{https://training.galaxyproject.org/training-material/topics/introduction/tutorials/galaxy-intro-ngs-data-managment/tutorial.html}",
note = "[Online; accessed TODAY]"
}
@article{Batut_2018,
    doi = {10.1016/j.cels.2018.05.012},
    url = {https://doi.org/10.1016%2Fj.cels.2018.05.012},
    year = 2018,
    month = {jun},
    publisher = {Elsevier {BV}},
    volume = {6},
    number = {6},
    pages = {752--758.e1},
    author = {B{\'{e}}r{\'{e}}nice Batut and Saskia Hiltemann and Andrea Bagnacani and Dannon Baker and Vivek Bhardwaj and Clemens Blank and Anthony Bretaudeau and Loraine Brillet-Gu{\'{e}}guen and Martin {\v{C}}ech and John Chilton and Dave Clements and Olivia Doppelt-Azeroual and Anika Erxleben and Mallory Ann Freeberg and Simon Gladman and Youri Hoogstrate and Hans-Rudolf Hotz and Torsten Houwaart and Pratik Jagtap and Delphine Larivi{\`{e}}re and Gildas Le Corguill{\'{e}} and Thomas Manke and Fabien Mareuil and Fidel Ram{\'{\i}}rez and Devon Ryan and Florian Christoph Sigloch and Nicola Soranzo and Joachim Wolff and Pavankumar Videm and Markus Wolfien and Aisanjiang Wubuli and Dilmurat Yusuf and James Taylor and Rolf Backofen and Anton Nekrutenko and Björn Grüning},
    title = {Community-Driven Data Analysis Training for Biology},
    journal = {Cell Systems}
}
                   

Congratulations on successfully completing this tutorial!