An Introduction to Genome Assembly
Contributors
Questions
How do we perform a very basic genome assembly from short read data?
Objectives
assemble some paired end reads using Velvet
examine the output of the assembly.
.enlarge120[
De novo Genome Assembly
]
With thanks to T Seemann, D Bulach, I Cooke and Simon Gladman
.enlarge120[
De novo assembly
]
.pull-left[
The process of reconstructing the original DNA sequence from the fragment reads alone.
-
Instinctively like a jigsaw puzzle
- Find reads which “fit together” (overlap)
- Could be missing pieces (sequencing bias)
- Some pieces will be dirty (sequencing errors)
]
.pull-right[
]
Another View

Assembly: An Example
A small “genome”

Shakespearomics

Shakespearomics

Shakespearomics

So far, so good!
The Awful Truth

“Genome assembly is impossible.” - A/Prof. Mihai Pop
.enlarge120[
Why is it so hard?
]
.pull-left[
- Millions of pieces
- Much, much shorter than the genome
- Lots of them look similar
- Missing pieces
- Some parts can’t be sequenced easily
- Dirty Pieces
- Lots of errors in reads ]
.pull-right[
]
Assembly recipe
- Find all overlaps between reads
- Hmm, sounds like a lot of work..
- Build a graph
- A picture of the read connections
- Simplify the graph
- Sequencing errors will mess it up a lot
- Traverse the graph
- Trace a sensible path to produce a consensus

A more realistic graph

.image-15[
] What ruins the graph?
- Read errors
- Introduces false edges and nodes
- Non haploid organisms
- Heterozygosity causes lots of detours
- Repeats
- If they are longer than the read length
- Causes nodes to be shared, locality confusion.
Repeats
.enlarge120[
What is a repeat?
]
.pull-left[
A segment of DNA which occurs more than once in the genome sequence
- Very common
- Transposons (self replicating genes)
- Satellites (repetitive adjacent patterns)
- Gene duplications (paralogs)
]
.pull-right[

]
Effect on Assembly

.enlarge120[
The law of repeats .image-15[
]
]
It is impossible to resolve repeats of length S unless you have reads longer than S
It is impossible to resolve repeats of length S unless you have reads longer than S
Scaffolding
.enlarge120[
Beyond contigs
]
.pull-left[
Contig sizes are limited by:
- the length of the repeats in your genome
- Can’t change this
- the length (or “span”) of the reads
- Use long read technology
- Use tricks with other technology
]
.enlarge120[
Types of reads
]
.pull-left[.enlarge120[Example fragment]]
.remark-code[.enlarge120[atcgtatgatcttgagattctctcttcccttatagctgctata]]
.pull-left[.enlarge120[“Single-end” read]]
.remark-code[.enlarge120[atcgtatgatcttgagattctctcttcccttatagctgctata]]
sequence one end of the fragment
.pull-left[.enlarge120[“Paired-end” read]]
.remark-code[.enlarge120[atcgtatgatcttgagattctctcttcccttatagctgctata]]
sequence both ends of the same fragment
We can exploit this information!
.enlarge120[# Scaffolding]
- Paired end reads
- Known sequences at each end of fragment
- Roughly known fragment length
-
Most ends will occur in same contig
- Some will occur in different contigs
-
evidence that these contigs are linked
-
.enlarge120[# Contigs to Scaffolds]

.enlarge120[# Assessing assemblies]
- We desire
- Total length similar to genome size
- Fewer, larger contigs
- Correct contigs
- Metrics
- No generally useful measure. (No real prior information)
- Longest contigs, total base pairs in contigs, N50, …
.enlarge120[# The “N50”]
.enlarge120[The length of that contig from which 50% of the bases are in it and shorter contigs]
- Imagine we have 7 contigs with lengths:
- 1, 1, 3, 5, 8, 12, 20
- Total
- 1+1+3+5+8+12+20 = 50
- N50 is the “halfway sum” = 25
- 1+1+3+5+8+12 = 30 (>25) so N50 is 12
.enlarge120[# 2 levels of assembly]
- Draft assembly
- Will contain a number of non-linked scaffolds with gaps of unknown sequence
- Fairly easy to get to
- Closed (finished) assembly
- One sequence for each chromosome
- Takes a lot more work
- Small genomes are becoming easier with long read tech
- Large genomes are the province of big consortia (e.g. Human Genome Consortium)
.enlarge120[# How do I do it?] — .enlarge120[
Example
-
Culture your bacterium
-
Extract your genomic DNA
- Send it to your sequencing centre for Illumina sequencing
- 250bp paired end
- Get back 2 files
- .remark-code[MRSA_R1.fastq.gz]
- .remark-code[MRSA_R2.fastq.gz]
- Now what? ]
.enlarge120[# Assembly tools
- Genome
- Velvet, Velvet Optimizer, Spades, Abyss, MIRA, Newbler, SGA, AllPaths, Ray, SOAPdenovo, …
- Meta-genome
- Meta Velvet, SGA, custom scripts + above
- Transcriptome
- Trinity, Oases, Trans-abyss
And many, many others…
]
.enlarge120[
Assembly Exercise #1
- We will do a simple assembly using Velvet in Galaxy
- We can do a number of different assemblies and compare some assembly metrics.
]
Key Points
- We assembled some Illumina fastq reads into contigs using a short read assembler called Velvet
- We showed what effect one of the key assembly parameters, the k-mer size, has on the assembly
- It looks as though there are some exploitable patterns in the metric data vs the k-mer size.
Thank you!
This material is the result of a collaborative work. Thanks to the Galaxy Training Network and all the contributors!
This material is licensed under the Creative Commons Attribution 4.0 International License.